Accelerating cell and gene therapy discovery
Peer inside the black box of biology through our interpretable biological simulators. Find the optimal wet-lab experiment to run—faster.
Improve editing efficiency and minimize off-target effects
Optimize directed differentiation transcription factor cocktail
Design vectors for targeted tissue and cell-type delivery
Peer inside the black box of biology
How Markov accelerates therapeutics discovery
Learn a dynamics model
We train our machine learning model on vast amounts of ‘omics data at multiple scales. This dynamics model forms the foundation of our simulator.
Shine a light onto the black box
Our interpretability tools shine a light onto the learned simulator, allowing it to be introspected and probed through natural language.
Accelerate therapeutics discovery
The combination of simulator and interpretability tools enables researchers to run experiments and analyze their results in silico, accelerating the early-stage research iteration loop.
Simulate biology in vivid detail
Our simulator has capabilities unlike any other
Support for all omics
Our simulators speak the language of biology, whether that be nucleotides, amino acids, or even images. Translate between and impute any modalities with ease.
Spatial and temporal capabilities
The complexity of biology isn’t captured in a static moment or in a single-cell. Simulate whole swaths of tissue at multiple spatial and temporal resolutions.
In silico perturbation with any therapeutic modality
Run in silico perturbation experiments with transcription factors, small molecules, capsids, and more—and use our interpretability tools to analyze which regions of your design matter most.
GCTCAGAAGCGCCGAGAGCGCGGCCGGGACGGTTGGAGAAGAAGGCGGCTCCCGGAAGGGGGAGAGACAAACTGCCGTAACCTCTGCCGTTCAGGAACCCGGTTACTTATTTATTCGTTACCCTTTTTCTTCTTCCTCCCCCAAAAACCTTTTCCTTTTCCCTTCTTTTTTTTTCCTTTTTGGGAGCTGAAAAATTTCCGGTAAGGGAAAGAAGGGCTCCTTTCGCTCCTTATTTCCCCGCCTCCTTCCCTCCCCCACCTTCCCCTCCTCCGGCTTTTTCCTCCCAACTCGGGGAGGTCCTTCCCGGTGGCCGCCCTGACGAGGTCTGAGCACCTAGGCGGAGGCGGCGC
GCTCAGAAGCGCCGAGAGCGCGGCCGGGACGGTTGGAGAAGAAGGCGGCTCCCGGAAGGGGGAGAGACAAACTGCCGTAACCTCTGCCGTTCAGGAACCCGGTTACTTATTTATTCGTTACCCTTTTTCTTCTTCCTCCCCCAAAAACCTTTTCCTTTTCCCTTCTTTTTTTTTCCTTTTTGGGAGCTGAAAAATTTCCGGTAAGGGAAAGAAGGGCTCCTTTCGCTCCTTATTTCCCCGCCTCCTTCCCTCCCCCACCTTCCCCTCCTCCGGCTTTTTCCTCCCAACTCGGGGAGGTCCTTCCCGGTGGCCGCCCTGACGAGGTCTGAGCACCTAGGCGGAGGCGGCGC
TACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAACCGTAGACCAGATAGCATAGACATACCGTAGACCAATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGATAGCATAGACATACCGTAATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACA
TACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAACCGTAGACCAGATAGCATAGACATACCGTAGACCAATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGATAGCATAGACATACCGTAATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACA
TACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAACCGTAGACCAGATAGCATAGACATACCGTAGACCAATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGATAGCATAGACATACCGTAATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACA
TACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAACCGTAGACCAGATAGCATAGACATACCGTAGACCAATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGATAGCATAGACATACCGTAATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACATACCGTAGACCAGATAGCATAGACA
Our mission is to radically accelerate biomedical progress
Advances in tools for studying biological systems have only recently begun translating into life-changing medicines for patients in need. It certainly feels like there is tremendous change afoot, with the potential for new biomedical breakthroughs growing by the day.
Markov’s mission is to radically accelerate the realization of this potential into actual biomedical progress. To do this, our current focus is building scaled, interpretable biological dynamics models for early-stage therapeutics discovery. By combining state-of-the-art machine learning with vast amounts of biological data, we are creating the tools to help research teams more effectively find therapeutics to advance into the clinic. Here’s how we’re doing that… read more
Build the future of biotech
We’re always looking for talented engineers and strategic investors to join our journey.